CShisMan2_1212


Sequence

>CShisMan2_1212 (3 EST) Length=314 ACTGTTAAAANATATTTACTTTAAAAACATAATAAAAGTGAATTAATGTAACATGATTTCGGTTATCGTTTCGGTAAAGA TTAGGTGAAACAAAGAATAGTTATTCCGCATTATCAAATGATCGTTTCCAAACGTTTGATTAACGCCTACCATATTTGTC CATCAGGGTCTTATTGACTTTATCTTTCGCCAATTCTACTGATGCATTATGCACTCTTTCAAACAGATGTTGACCGAGTC CCACAGACAATCGTGATCCTCCTCCTCCATGAACCTCCATATATGGATTTTGAAATACTGACACAAGGACCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1212: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824101713248AA143843MCCE0213.M1FSchistosoma mansoni, cercariae
7824111713249AA143844MCCE0214.M1FSchistosoma mansoni, cercariae
17370973190017AA999462MCCE3326.M1FSchistosoma mansoni, cercariae


Date: 16:12:7 on Sun 19 Nov 117.