CShisMan2_1213


Sequence

>CShisMan2_1213 (3 EST) Length=370 AGAAGGTAGACATACCTCAACAGGTCAGAATGGTGATGGCTCAACTGGGACAGGGTCTATGAAACCTGAANATNCCAATA ACTAAGTCGAGGGTATCTTCCCAACAACATTCTTTATTTAACTTTATCGTCTGTCAGTCCTATTACTTTCACNTCAACTG TTAATTAGGGTGATTAGTCCTAAAAAAATGTTTTATTAGTTTGAGGTTTCTCGCTATTATACATGGTGATCAACAGTTCT TTGTGTTTGATGAATCTACTACACTTGTTTGTTTTCAACTCTTCTTTCTTTCTCAACCGGATGCTAATTGACTTTCATGT TATTGTTTTTTACCAAGTTTATTTGATGTTGAAATACAGTTTTGGATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1213: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39389514783T14616SMEST0277Schistosoma mansoni, adult worm, Gloria Franco
5136931444946W06726SMEST0362Schistosoma mansoni, adult worm, Gloria Franco
12100162330305AA559609MC080547.NA3TBRI-Saber-cercaria-A


Date: 2:43:19 on Thu 23 Nov 117.