CShisMan2_1217


Sequence

>CShisMan2_1217 (4 EST) Length=315 ATTCAATTATTTTATATTTAGGCACAAAGAGGAAATGTTGACATGATTTAAATGTGAAACATCATTAGGAAAAATGACAT GAAAGAATAGAATGAAACAAATATAACGTAAGCGACACGTTGTGCTGAAAAAAAAGTAAGACCGGTTGCCATCATACCAG AGACGAGCCAAAAAAGATTCATTCAGTGTTTACATAAACTAAAATGCATATTCAACAAAAACTTGATAGGAAAAACCAAA CCACCACTGACAGATATTTTAACACATACTAACATTTGTGAAAAATAGATAGAACGAAATGTTTTGAAATAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1217: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824161713254AA143849MCCE0223.M1FSchistosoma mansoni, cercariae
12165742338823AA566191MA3MR065.AA3S. mansoni adult Lambda Zap
17368563189776AA999221MCCE0268.M1FSchistosoma mansoni, cercariae
17370863190006AA999451MCCE3312.M1FSchistosoma mansoni, cercariae


Date: 14:55:9 on Sun 19 Nov 117.