CShisMan2_1220


Sequence

>CShisMan2_1220 (2 EST) Length=317 GTTTTTCAATAGACAGCACCGATAGTCTCGATAATATCACTGAGAAATGGTATCCTGAAGTAAAACACTTCTGTCCAAAT GTTCCGATCATCCTTGTGGGTAACAAACAAGATCTGCGTAATGATGAGCGGGCACATCATGAATTAGCCAAAGTTCGCTC AGGAATTAGTCAAATCCGAAGAAGGTCGCCTTGTATGTGATCGTATTAATGCTTATGGATATTTAGAGTGTTCTGCTAAA ACAAAGGAAGGTGTTCGTAAAGTTTTTGAGACAGCTACACGTGCTGCTTTAAATACTAAACGTAAAAGAAAGAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1220: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291831145909N28053EST00299S. mansoni cDNA
9100711906136AA269039MA1MA039.AA3S. mansoni adult Lambda Zap


Date: 14:41:15 on Fri 17 Nov 117.