CShisMan2_1229


Sequence

>CShisMan2_1229 (4 EST) Length=313 AGAATAATCCAGGTGTATTTACAGATACAAATTTAAATAAATAATCACCTGTTTATGTAATTCAGTAGTGAGAAAATTAA ACAATACAATCAAATATTGTTAAAATGCATAAACAATATACACAGAATAAAAATAGCAGTTGGACACAGAGAAACAAGAA AATCTAAAAATATAACACAATGAGAATATCACTTAGTGGACAACAAAAAACGGTAAACAATGCAAAATTCCATACTAATA ATGAGCATTACATACAAAACAGGAATAACATAAGTTATTGATTAGGATCAAAGTCATTGTGCTCAGATTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1229: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370853190005AA999450MCCE3310.M1FSchistosoma mansoni, cercariae
17371493190069AA999514MCCE3423.M1FSchistosoma mansoni, cercariae
17372483190168AA999613MCCE3585.M1FSchistosoma mansoni, cercariae
17372733190193AA999638MCCE3651.M1FSchistosoma mansoni, cercariae


Date: 2:45:50 on Sat 25 Nov 117.