CShisMan2_123


Sequence

>CShisMan2_123 (3 EST) Length=597 GGAAATTCCTGTCTATCTTATTGGCTGTGTATGGAAGAATAAACCGAAAGTATTTCAACGTGCATTATATGATTTCACAT TGGGTTCACAAAAACTTTTACAATTAATACCTGAAAGTNGAATTGGTTACCGACTTCAATGTGTGCTCATTCAATACACT AGCACACTTGCACACACACACAATGTCAAATGACAGTATTTATTTACAACATAATGACTATTATTATTATTAAACTCGTT TTATTTATAACATTTAAAAAACTTTAATTAACACGTTAAAGTTCGATTGAATCCACAGTTCATTGTATCCACTTGGGAGC AATTGATGAANACTATTAGCAACTTTGATATAATTCATTGGTTACTAAGTTAGTAACTCTAAAGTATAGCATAGAAATAT GCTGTATACTTGATAGTAAAGTTACTTACTTACTTACACTTGTTACACCCAATGGAACACAGGCCACCGACTATCATTCT CCAACTCACTCTGTCCTGAGACTTCTTTTCTAGTTCTATCCAACTTTTGTTCATTCTCCTGGGTAGTAAAGTTGCATTAT TATGGATTTGATAAAGTGAACTTATTTACAAAACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_123: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694643509865AI110895MF003D04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696593510060AI111090MF001B09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696663510067AI111097MF001B01.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 14:23:34 on Mon 20 Nov 117.