CShisMan2_124


Sequence

>CShisMan2_124 (2 EST) Length=594 GTTAGTGTGCAGCTTGCTGGGCAGCACGCTGAAATTTTTCAAAAAAACAGATAAAACCTTAAAAAAATCATAAAATCATA GAAAACCACAAAAATATGGCTGTTAGTGCAGCGAGTCAAGGGTTGATGAATTCATCCCTATATGTTGGAGATTTACACCC AAGAGTTTCTGATTCCGCGTTGCAAGCTAAATTTTCTGAAATCGGTCCAGTCCTTAGTGCTCGTGTCTGCCGGGATCTAG CCACTCGTCATTCTCTCGGGTATGGATATGTTAATTTCGAAGATCCAAAGCATGCCGAACAAGCGCTTGAAGTCTTGAAT TATGAGTCACTAATGGGACGCCCTATCAGAATTATGTGGTCACAGAGAGATCCATCTTTGAGGAAATCTGGGAAAGGAAA CATATTTATCAAAAACCTGGATAAATCCATTGAACAGAAGGAATTGTATGACACTTTTAGCTTTTTCGGTCGAATCTTAT CGTGCAAAATTGTTATGGACGAAAACGGACAGTCCAAAGGCTATGGCTTTGTACATTTCGAGAAAGAAGAGTGTGCCGAA CGTGCCATTGAGAAGATTAACAATATGATTATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_124: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145753384935AI066968EST208633Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158083386168AI068201EST209892Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:17:37 on Thu 23 Nov 117.