CShisMan2_1248


Sequence

>CShisMan2_1248 (2 EST) Length=321 GGNGTGTTGCCAATTNGANTACCCCAGATATCCNGTTCCGGAAACAGGAANTANTGACAGNTTAGCCTGAAGGATAGCGC CTNTAATNGGAGNAGCGACCTCCTNAGCACATTTTACTCCTAGCCCAACGTGACAGTTATGGTCTCCCATTGCAACAATT GCTTTAAAGCGGGTTCTCTGGCCAGCACAAGTCTGCTTTTGAACTGGCATGATTTTAAGTACTTCATCTTTTAAACTTGA ACCCAATATGGTATCTATAATTTCACACTCCTTAATCGGGAGACTGAACATGTATATTTTCTTCTAATGTAGTAATTTCC T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1248: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621871196854L76116SCMRAP0201C2/S1 day seven schistosomula mini-library
12098272330116AA559420MC250434.NA3TBRI-Saber-cercaria-A


Date: 17:40:57 on Mon 20 Nov 117.