CShisMan2_125


Sequence

>CShisMan2_125 (9 EST) Length=637 CCTTTATGCGCGTGCTACTAAGGAGAAATGCGCAGTATTCGAGGAGTGGTCGAACACAGACTTTGTACATTAGAATACGA GATTTGCTGTTATGAATGTTTCGAGTTATGTAACCTATAAGGCGTGGAGACTTAGACGCTTGTATCATTATCTGTTCAGT AAACGACAAGTCGTCGGATTACCTAAGTCCTAGATCTACTACTGTGTGTAAGCTAGATAACATTTCACCATTTATGGTAA GATCGAGGTTGAGTGATGTATCACCGAAGCATAACCAACCACATTTAGCTGTATTAAGCTCTAGTTGCCATTTCGACCAC CACTGTGCTACCTTGTTAAGCTCCATGCAGATACAATTTTGAATATTGCTCAGCTCATGTGGAGAAAATGAGTACACCAC CTTAAGATCGTCTGCAAACAAAAGGGACTTACCCACACTAAAACACTAACAAATATCATTAATGAAAACTAAAAAGAGCA AAGGACCTAGTACACTAACCTGAATTATCCCACTTCTAACAGGGACTGCATTCGGCAATGGAGAGTTGATTTTAACTATT TCATGTTGATTGCTGAGGAAGGAATCAAACCAGCTAGTAACGGGTTTCGNCCCCATAAGATGCGAGTTTACCNNTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_125: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344385972786L46918SCMRAP005LA1/LA2 adult worm mini-library
344446972847L46979SCMRAP066C2/tcz2 adult worm mini-library
344467972868L47000SCMRAP087G1/G2 adult worm mini-library
18145943384954AI066987EST208652Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147873385147AI067180EST208852Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148943385254AI067287EST208964Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149263385286AI067319EST208997Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150033385363AI067396EST209077Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158773386237AI068270EST209961Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:23:56 on Sat 18 Nov 117.