CShisMan2_1253


Sequence

>CShisMan2_1253 (5 EST) Length=313 AAAAATTACAAAAAGCTCTTTATCACTATGGACCAATTTCAGTTGCTATTGATGCATTGGATGATCTTATACTATATAAG AGTGGAATATATGAATCAAAACAATGTTCATCATTGCTTATTGAATCATGGTGTATTAGCTGTTGGTTATGGTAGAGAAA ATAGAAAAGATTATTGGCTTATTAAAAATAGTTGGGGTACTACATGGGGTATGAATGGATATTTCAAATTAAGAAGGAAT AAACATAATATGTGTGGTATTGCAACAAATGCCAGTTTCCCATTATTGTAATCTATTCATTACATTTTAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1253: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345028981295R95635SMNHADA019066SKSmAW
11587342252911AA514055MA2MA119.AA3S. mansoni adult Lambda Zap
18146893385049AI067082EST208752Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152173385577AI067610EST209292Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157233386083AI068116EST209806Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:17:45 on Wed 22 Nov 117.