CShisMan2_1255


Sequence

>CShisMan2_1255 (2 EST) Length=451 GTCATTTGAAATATAAAGGATAATCAAGAGGAAACTTTGGCATTCGAAAGATATGAATATCTTAAGTTTACGTAATAAGG AATATCTCTATGTAAAAAATTACTATTATGAACAATCAAATCTGTGAAATTAATTAAACTAATAAACATTCAAGTGATAT CATAAGATTCGTAATTGTGTTTGATAGTTAAGTGAAACTTTTGTACACACTGAATAGCGTATGATGTCTATTTCATTTAA GATAATTAAAAGTAACTTGTTAACTTCTCATCCTTTTTGCCCAATAATGCTGTTTCTAATGCTGTTATCTAGCAATACTA TTTTTNCTAAAAAAAATTGTTTTATAAATTACAGTTGACTTTACAGTCTTATCATTGTCTTTNCGAAGCTACAATTCTAT TTGTGATATTTTTCCTACTCTGTTTGAAATAAATNCTGTTGACTGTNCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1255: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099732330262AA559566MC070571.NA3TBRI-Saber-cercaria-A
12099782330267AA559571MC070577.NA3TBRI-Saber-cercaria-A


Date: 22:13:47 on Sat 18 Nov 117.