CShisMan2_1257


Sequence

>CShisMan2_1257 (4 EST) Length=624 CGAACATTCGTAACTCCTTGTCTTTAGCGAAACAAACATATNCTAGATCTNCTCTCTATATGAATTACTTTACCTGTATA GTTTTCTATGACTCTGGNAATAATTTACCCCAAACTATCCGTATGTTAAACTCTCTCCCATTGTTTGTTCGCTCAATTAA TGCTTTGTGCTCCTCTGAAAATGCATTAAATGCTCTAGCGCATGCAAGTGTATCTTACTCCACAAGTGAGATTATAGGAA CTTTAAATGTTTAACCTCTTACTTGCTATCATTGTTTTGTTGTTCCGTGCTCTTTGCTTTAATCTTACTTNCTCTAGTTG TAGATAATTAATAATAACTTGCTCTGGCACTGGAAACAACCTTACAGAACAATGTTGATCAATCATCAGGCTATCCACTT AATAAAAAATGACAAGTTCCCCTGGTGTTGCATTGGCCTCTTTGCCGTGACATATGCCATATTTAAGCTAATTATCAATT ACTAAACCAGCAAACATAAAACTTTCTTATATTTCATGTTTGTTCTCTACATTAAATGTTGATTTTGATAACAATCTGAT CATGCTGTAAACTGGTGTGAATTCTGTAAATATTATTTTCAGAATATATTATTATTATTATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1257: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350301154054N33655SMNHADA008089SKSmAW
9100411906106AA269074MA1MA009.AA3S. mansoni adult Lambda Zap
12100192330308AA559612MC080552.NA3TBRI-Saber-cercaria-A
15130232854303AA791348SMTBADA000838SKSchistosoma Lambda Zap II


Date: 14:11:15 on Sat 18 Nov 117.