CShisMan2_126


Sequence

>CShisMan2_126 (16 EST) Length=1229 GCACGAGTATTATTATTAGGTCTTCCTGAAGTGTGCTGTTCTAATTGTCATTTTACAATCTTATACAATTATGATTGAAT TACGTCGTTTATCTACTATACTTCTTGGTCTTGCTATAACATTAATTACGATTGGTATGGCTACATCACAATGGAGATGT GGTGGATTATTTGATTCATGTCAAAGAGGACATTCAAAAGATGCAATTATAGCTATTGTAGCATTATTACTTATTGGAGT TATTGCTTTAGCAGTTGTCTTTTTACTAGATCTCATTGGATTGTGTTCAGATGTAATTGTTGCTACTGCAGGTTATGTAA CTGCACGTTTTATTTTATTATATTTGGGTACAGCTTGTTTAGTTACTGGTATATTAGTATATACTGGTAAATTTGATCAG ACATGGTCATATTTTTTGGCTACTGTTGGTGGTGTATTTGCAATGCAAGTTGCTATTTTAGCTATAATGAGTTCACGTTG TATATCAGTACGTACAGAACGAGTTGTTGTACGTTCAACACGTTAAATGACGAGATATTTACTGGGAAACGTTTTTTTAA ACAAATCAACAGATGAACCAGTTGATCTATTCGTTTATCCCCTTCAATATGAAACCTACTTTTAAATGCTGATCAATCTC CATATCTAATCTATACTGCATGCTATTGGATTGTAAGTTTCTTTTTGCATTATTATTTTCATGAATTCGCTTCTATTTCA CATGCATATACCAATAACGTGTAAGCTTTATATAAATCAATTCTACGTTAGCCATGCTTAAGTATTTCCCCTATTTATTA CCCATTTCATACAATAAACGTTTAATATCTACATCTTACTTACTTACGCCTGTTACCCCTCGTCAAGGAGCATAGACCTC TCACCATCATATCTATATCTATATCAGCTTATATCTCTATGTGAATTTCCCATATCAGAACAAGAATCAGTATTCAACCA TTTTGTATCTCTATGTCTTCAGTCCATTATATATATATATATATTACCCTTGCNTTACATTTTTTTATATTCTTCCAGCT AACTATGGATACAAATATGTTTGTTCGTTTTTGGTGTAAACAGATATATGAAATATCCTATTTGTTTAATTGTCTCCATT TGGGCTCCAATTTAAAATTTAGGCTGTACAATCTTTTATTATTATTATTATTATGGATATTAAGATTNNCTNCGCTTTTA ATAATTGGGGAATAAAATNTCAAATATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_126: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39308514702T14535SMEST0196Schistosoma mansoni, adult worm, Gloria Franco
4191391127990N21857SMNHADA018090SKSmAW
15130462854326AA791371SMTBADA000937SKSchistosoma Lambda Zap II
18145983384958AI066991EST208657Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147843385144AI067177EST208849Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149253385285AI067318EST208996Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149463385306AI067339EST209017Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149713385331AI067364EST209043Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149883385348AI067381EST209062Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152223385582AI067615EST209297Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153643385724AI067757EST209440Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154283385788AI067821EST209505Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156003385960AI067993EST209682Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157803386140AI068173EST209864Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157863386146AI068179EST209870Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694353509836AI111148MF003F09.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 21:16:48 on Fri 24 Nov 117.