CShisMan2_1261


Sequence

>CShisMan2_1261 (2 EST) Length=313 CTTAAATCAGGGCTGGTGAAAATGCTACTAGCATCAGTGATGACCCTTACGTACAGATATTAAAAAATTCAGGTTTCACT GTAAACTTGCTGGAAACTCTAGATTTCGAGTATAACATATCAAATCTAGCGGAATACAAAANTTGGAGGAACAATCACAG TTGCATTATTTTTAGTAGCCCACGTTCCGTAATCGCTTGTGTTAAAGCTGGACTAACACGCAATGAAAAATGACCTTTGT TTTCGTTGTNGGTCCTAGCACTGAGTTACAAGCTAAAAAGGCTGGATTTTTGCCTAAGGGANCGGAATCTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1261: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100112330300AA559604MC080537.NA3TBRI-Saber-cercaria-A
15900252956649AA864170SMTBCEA000033SKSchistosoma Lambda Zap II cercariae


Date: 10:36:8 on Mon 20 Nov 117.