CShisMan2_1262


Sequence

>CShisMan2_1262 (3 EST) Length=470 ATGAACGAACATTCCTTGTTCAATCTTATTCATAAAACATATCATAAACAACTATGAATTGAAATTGTCGAAAGTAGAAA GGGGAAACCATAATTCGGAATACCAAATAGCTTAATCATTCAAAATATATAAAAAGAAGTCTTATAGTGATAGTAATAAT ATACATTTAAAAGATAGACGCTTAGGTTAATCATGAAATAAAAATGGGTTAATTCATAATCATATAAATTTATAATAACA TCAATATGTTATATAGTTGCAGAACAAGTAATGTTTATCCCGAAAATAATGAATTCAAAAATTCGTACTGTCAGTTTTAT TATTAGGTTACTATGATAGTTATGAATGTAATTGAGTCAATGGTAATTAAGAGAATAGTGAATTGCAAAAGTTAAAAAAA AAATGTTTTTCATTCATTGATTTTTTTCTCGTTTTTTTGTTGTTGTTTATTCCTCAATATATTTCCTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1262: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16451963056529AA917135SMTBCEA000079SKSchistosoma Lambda Zap II
17368733189793AA999238MCCE3020.M1FSchistosoma mansoni, cercariae
17371943190114AA999559MCCE3484.M1FSchistosoma mansoni, cercariae


Date: 21:46:44 on Fri 17 Nov 117.