CShisMan2_1265


Sequence

>CShisMan2_1265 (3 EST) Length=456 GCAACATANGGNCTGATGGTCGAGAATAGATACATGCNAAGTNGGGGGCTTTTGGAANTTTCTAACTTATCTCCCTCCAN AATATCGGAAGCTTTAATAACGGTGTAGGACNAAGTCACCCGTGCCATATCTGTTTTCGGCGGANTATCTGCAGGAGGCT GAAAAAGGTGTAAGAAAAAGGAAGGACGAAAAGCAGAGCACACAATATTCATGGAGGAATAGTTAAGGTATAACCATTTA GCCTATTTGTCTGTTACTGAAGTACTTACTGAACTAAGAACATACTAATGTGTTAAAGANAAATAAGTGTGAACAAGGTA TGAGTGGATAAGGAACTGTAGAAATGAAGGTAGTTCAGAAGGAAGTATGGAATTGTGTAATTATAAAATAAAGTGCTGAA AACAGTATTCCGATAAAAAAAAAAGTCACCACGAAAGNAAAAAAAAAAAAAAAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1265: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344412972813L46945SCMRAP032C2/C2 adult worm mini-library
5858861377947U58068SMU58068Schistosoma mansoni adult worm Lambda ZAP II library
12100052330294AA559598MC080527.NA3TBRI-Saber-cercaria-A


Date: 12:44:27 on Sun 19 Nov 117.