CShisMan2_1267


Sequence

>CShisMan2_1267 (3 EST) Length=358 AATTCTCGAATCTTTTCTGATATTGCTANAGTGACAAGTCAAGATGATGCATCTNNNTTTTTTTTTTTTTTTAAGTCGAG CAAAGCCCACCCACTATTTGTTCAACATTCAATAGAATTCAGCACTGAAGCCAAGTATCATAAACTTGTGATGTGCCATG GGGTATTGAAAAATATCTATTTTCTTATTCCATATCCAAACATATTCTTAGCNGGATTTCAGGATACTTCTTATAAATGA TTANCATTCCGTTTAAGTTAAAAATAAATATTTTCATCTCATTCAAGTATTGCACACTTTGATCCCGAATTCCAGCTGAG CGCCGGTCGCTACTCAGGATCCCCCACACTTTGATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1267: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103121907430AA269309MS1MM014.AS6S. mansoni sporocyst Lambda gt11
9103251907443AA269322MS1MM017.AS7S. mansoni sporocyst Lambda gt11
9103271907445AA269324MS1MM018.AS7S. mansoni sporocyst Lambda gt11


Date: 16:16:20 on Sat 18 Nov 117.