CShisMan2_1268


Sequence

>CShisMan2_1268 (2 EST) Length=386 CATCAAGTANTTNGCTTAGTCATTCTCGACACAGCCTACATCTTTTGTTTTTAATAATCTTCTTGTTTTTCTGTAAGATC TGGAACAACACATCCTTAAAGAGATTGTTTACTCCATTGTTTCAAACTTGAATCTTCCTTTGACTTTCCACCTCATACAT AGNAAATGTTGTTACCTTTTCTTTGATCTCTCCTTCATATTCCCTTTAATGTGGTCTTTTATTTCTTCTNTTTCATTTAC ACTATGTGATTTCCCAACTTTAGTAGCGTTTTACTGGCTTCCAGTGNTGAGTGTTTGTGTTCAAAACAGTACTTAGTTTA AAATAACTAGGTTTATTTATAGTTGATATACATCTGGAAAAATAATATACATATAATTTCCCGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1268: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099862330275AA559579MC070595.NA3TBRI-Saber-cercaria-A
17371823190102AA999547MCCE3472.M1FSchistosoma mansoni, cercariae


Date: 8:50:24 on Mon 20 Nov 117.