CShisMan2_1276


Sequence

>CShisMan2_1276 (3 EST) Length=339 GATCTTGTAATGGTAGTTCTTGCATGATTACAAAGATTTCAGGTCGTAGACCCGTAGTAGTAGTATTCAGTACAATGGTC TATCGATTATAGCTTGATGTCTTTCTGGCTGAACTCCAAGAACCTCACAAAATCTCCGAAAAGTTATCTTCCCTGTTCCT TCAGGATCGAATAGTGCTTGCCATTTCGGTATCATTTCTTTATCTAAATGATTTTCTGCAACATAATTACGTAATTCATT AATTGTAATAACATTAACTCCTCGTTTGTCAATAGCACCAAATGTAGTAATGAATGGTTNCCACTCGATGCCGTATTTTC AACGTTCCTTTCCCTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1276: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098072330096AA559400MC250407.NA3TBRI-Saber-cercaria-A
12098972330186AA559490MC270415.NA3TBRI-Saber-cercaria-A
12165902338839AA566207MC3NE030.ACSS. mansoni cercarial Lambda Zap


Date: 12:21:5 on Fri 17 Nov 117.