CShisMan2_1279


Sequence

>CShisMan2_1279 (3 EST) Length=462 AAATCAGTATATTTACTTGATATCTATATTATTATAATCGTAACTAATAGAAGTAATGATGAAGAAACAATTTTTAGTTG GATATTTCATACAGTTTTGAATAGAAGAACTCCGCGATCTTCCAATGGGAAATAAATACAGANTTGTTTTATATGCGTTA CATAACTTGAAAATTTACTTCCAATAATACAATGCCATGTTGGTTCATATTTACGATCANATTCTTTTTTTANAAATAAG GCAATGATCTTTATCAATCAATTATATTTATCCATAGCCATTGCAGCAGTTTGTACAGGCATCTTGTTGCATTTCTTTAC TCATTTCAACATATTTAATAACAGCATTTTCTTTCACCAGACTTTCATGTATAACATTACTATATGGTCTTTGTTCAATT GGCATCTTTTCTGTTTTTCAGAATTTTGTTTTTTTTTGGGTTATTTTGTTATTATCTCGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1279: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191401127991N21858SMNHADA018091SKSmAW
11587312252908AA514104MA2MA116.AA3S. mansoni adult Lambda Zap
12165352338784AA566152MA3AS039.AASS. mansoni adult Lambda Zap


Date: 9:16:51 on Sat 18 Nov 117.