CShisMan2_128


Sequence

>CShisMan2_128 (10 EST) Length=738 ACGAATAATGATATAGCAGCGTTAGAACGGAATGACAAAAAATCTAAATGGACAAACAATTGAATATATATCCAGATGAG AAAAAAGAAACAAGGTCCGAATAGTGATTTACAGGGGTTTTCAGCGGAGAAACAACGGAAAGTTATTTCTTGTACGCANA CATAAAAAATTCAATGGTAAAGTAACNACAGTTTGTTTGTTTGTTTTACCAGGAAAGATATGCGTAGAAGTGTCTGTGGT GAAAGTCAAGTGTGAAATTTTAAGATAAAAATTCAGTTTACTGGATTATTTTTCTTCACACCATTCATTTTCTTTTTTAA CTTGTTCTTCCTCCTGGGGNGTGAAATCACACTTAATATTGAAGGTTTTTCGTATTTCTTCTGGTGTTTTCCCTTTGATC ATGTTAGCTACAGTTTTACAGCATACATCCAAGAGTCCCCTAATATCGAGATAGTTGGCTGCTAGCATCAACTCAAACAA TGTTCCTTGATCGACACGAAGAAACTCTTGGTCCCAACTAGGAATATCGTCTGTACGACGTTCTTTGTTTTCGTCATCTT CCTGGGGTGGTGGATCGTCTTTGTGATAGGTGCACCACTGAATAACTTTACGCAGAATTCCAGCATTAACATTTGGGAGG GGAACTGGCTCTTCATCTCCTTGCTCCTCCAACCCTAAATCATCCAACATGGTTTTGATGGTAACGGATTGTTTTGCGAT AGCCACATCTATATCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_128: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097432330032AA559827MU001016.NH3York-Harrop-lung-A
12098792330168AA559472MC260470.NA3TBRI-Saber-cercaria-A
18694023509803AI111115MF004A08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694323509833AI111145MF003F12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694863509887AI110917MF003B04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695293509930AI110960MF002F09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695323509933AI110963MF002F06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695773509978AI111008MF002B06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695803509981AI111011MF002B02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696543510055AI111085MF001C02.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 15:4:11 on Wed 22 Nov 117.