CShisMan2_1284


Sequence

>CShisMan2_1284 (4 EST) Length=794 CTCACTCACATATACTAAGCACAACTTTACGTATATACATAGTCCTTATACAAATTTGTAATCTTCAATTCACCATTTTA TTAGATTCTTCTTTCTTTCAATCAAATTGTCATTACAAAAATTCTTCCAACTTATTCCTGGAATCATTCCTTCTAGTCAT ATTAAGTAATTGGAATGATATAAAACAAGGCTATAATAGTTAATATTATTTAAGCTTTACTAAGTTCATTNGCTTCACTC TTTTTTCTCTTGGAAAAACACCCTTCAATTTGTTTTATATAGTGTGTTTTATGATCATTCTTCAATTTAATTTTGTTTTA ACCAATGCATTTGGTGTCGGAACCAGCCTTTGTTTTTTTCAATGTTAAACTACTCAAATGTTGTTCAGTAGCTAAATGAC TAGCAACTATAAAACATGATCATGGGAAATGGTTAGGGTTGTCCATTTCTGTAACTATATAGCTACTTATAATTAATGAC AATAGAATATGGTTGATGTAAAACTTCTTGCTTTCGGAAAGTTAGTTTTTAGTTCAATTGAGCAATAGAAACATGTTGTG AAAGCTAAAAGAAGTCTTGTTCTTTTGAAAAATAGTTAAAAATTCGGTACAGAAATTTTAGAATTTTATNCTTTGTAGAA TAACTTATCTTAATTTTTTTATAGAAATAAATAGCTTATTATTGTTTTCACATTTGGATCTGATTTAATTGGTGTTGTCT AAATCACTTTTATGTAACTTATTATTATCATTATTATTCAGTTAATAAAGATAATTTTAGATAGAAATTTGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1284: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179931125882N20710SMNHADA002026SKSmAW
8578451832605AA218512MAAD0189.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
17371293190049AA999494MCCE3393.M1FSchistosoma mansoni, cercariae
18694303509831AI111143MF003G02.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 4:44:46 on Sat 25 Nov 117.