CShisMan2_1285


Sequence

>CShisMan2_1285 (4 EST) Length=352 GATCCTCAACAAACTTTATTAAACGCTTTGTATTCGGTTCTTTACGAGAACGTTCTTTCGCAAAAGTTTGGTGGTAACAT GCCATCTCTGACCGCTAACATATTGATACAGTCATCTATTTCACCCATCGACCGGATTGATCCAGATAGATCATATGTCT TTTTACTCCCACCAATCATGCGTCCTGTAGTTGGGTCCAAATCAACAAACTGGATCTGGATTGAAGCATGATCTTTTGCA CCAATTAGCNCTGTTAGTAACAGCACACCTTCTCGGCATGTAAATGTCTACAAACTCTCCAGCCTCGTTCTGCATCGTGG TTGCTCGAATCTCCCTGGAGAAATGAGAGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1285: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350215988846H49005EST000095S. mansoni cDNA
4071511119157H98272SMNHADA015046T3SmAW
4192131128064N21931SMNHADA020032SKSmAW
7790831702742AA140582MEEG0118.M1FSchistosoma mansoni, egg stage


Date: 7:33:12 on Sun 19 Nov 117.