CShisMan2_1286


Sequence

>CShisMan2_1286 (13 EST) Length=360 AGGCATTAAAAATGTATATTTAGAATTTATATTGTTAATAAAATGTCAATAGTTACTTTGTGTTAGTTATTTTAAAGAAA TAATTTGATGAACTATCTAGGAATTTCTGTTATATATAATTAGTGACCACCGTGATCTTTTCCAGATCCTGGTTTATGAC AGCCAGTTTCACAATGTTGTGCTTTGTCATGAGATCCATGACCAGCAGCATCTTTGTCGTGGCAGTCTTTCGGACAGTGT TCAGATGATGTGCAATGCTCTTTGCCTTCATGACCATGATGGCCTTCTTCATGATGTTCATGATGATGTCCAGATCCGTG AGAAGACATGGTTGATAATAACCACGTTGCCGAGTTTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1286: (13 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824031713241AA143836MCCE0205.M1FSchistosoma mansoni, cercariae
12098802330169AA559473MC260472.NA3TBRI-Saber-cercaria-A
12099022330191AA559495MC270422.NA3TBRI-Saber-cercaria-A
12099272330216AA559520MC070505.NA3TBRI-Saber-cercaria-A
12099282330217AA559521MC070506.NA3TBRI-Saber-cercaria-A
12099962330285AA559589MC080517.NA3TBRI-Saber-cercaria-A
12100262330315AA559619MC090703.NA3TBRI-Saber-cercaria-A
12101092330398AA559702MC031046.NA3TBRI-Saber-cercaria-A
12101132330402AA559706MC031058.NA3TBRI-Saber-cercaria-A
12101762330465AA559769MC210213.NA3TBRI-Saber-cercaria-A
12101782330467AA559771MC210215.NA3TBRI-Saber-cercaria-A
17368463189766AA999211MCCE0098.M1FSchistosoma mansoni, cercariae
17368473189767AA999212MCCE0098.M1RSchistosoma mansoni, cercariae


Date: 2:49:6 on Thu 23 Nov 117.