CShisMan2_1287


Sequence

>CShisMan2_1287 (4 EST) Length=479 GATATGTATCCANATATAAAAAGCCATTATATATATATATATATCATTAATTGTCTAAGCATAAACTTATGNATGTAAGG ATGACTACATTATTTACTAAATCACTGTAGCAACACAATATCTGACTATAATGTTGTTTAGAAATAAATCAAAATCATAA TGAAATTTATTGATCCACTTCCGTAGATAAACAAATTTCATAATGATATATGAATAACGAAAAGATTTTTTTTAAAAAAA AGAAAATTTGAGNAAATAAACACAGAATTTTGAGCAGCAACAATTTTACTAACCTGAGTATGACTAATAAATTTGTACTA AATAATCGAAACGAAAACATTATGTCTAATTTTTTTTAAGTAAAGGAAGCACGAAGCTACAATAGTATCAAACAAGTAGG TAAAGCTGTAAATTAATTGTATACTGTAATCAAAGAAGTGGAATTCTTCAGTTAATTTCATCATTGTATGTTATACTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1287: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102211906286AA269218MA1MR041.AA3S. mansoni adult Lambda Zap
11587472252924AA514068MA2MA132.AA3S. mansoni adult Lambda Zap
12099582330247AA559551MC070550.NA3TBRI-Saber-cercaria-A
16099762992125AA883014SMTBCEA000042SKSchistosoma Lambda Zap II cercariae


Date: 10:41:31 on Mon 20 Nov 117.