CShisMan2_129


Sequence

>CShisMan2_129 (13 EST) Length=590 GCACGAGCTTCAGGTCAACTAATCAACAGGAATTTCTTGAAGAACATATCAGTGACAATGTGGACAATAATAGAACTTAT CCTATTGAGACATCATTTAGATATCACACATTAACAGATTCTAATCAACCTAATGAGTTGTTGATAAATTCAAGACATGA TATGCCTGTTACAGTAATACCATTGGAAACGTCAGCTTCAACTAGGTTTTATCAATCATTATCAGAAAGCAATAATCAGC GTACTCTGATTGACAACATTTCATCAGAATTATCATCATCGTCTTCTGTTCAAAGCAAAATATCAAGGAACAAAGATTTG AAGTCTTCAGCAAAATCAAACAGTTTGATTCAACAATCGACTGATTTAGATTTATTTGATTTTTTAAATACTAAGTCAGT CAACTCAGATCAAATCACCAATCCATTGGAACGAGACGTAGTGAGACGAGATTCTTTACTATCTACTAGCGATAAAATTG AAGAAGATCAGAGTAGTGGTTATGAAACATCTCTATCGACTAAACATTCTGGCACACCTATTAAAACAAGTAAAGGGGAN GAGAGTTTCACTGTAACAGCTGTTCATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_129: (13 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146613385021AI067054EST208723Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147323385092AI067125EST208795Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147613385121AI067154EST208825Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148143385174AI067207EST208881Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149693385329AI067362EST209040Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149783385338AI067371EST209050Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150563385416AI067449EST209131Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150693385429AI067462EST209144Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153443385704AI067737EST209420Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154293385789AI067822EST209506Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155073385867AI067900EST209587Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159203386280AI068313EST210004Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159213386281AI068314EST210005Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:12:23 on Wed 22 Nov 117.