CShisMan2_1290


Sequence

>CShisMan2_1290 (5 EST) Length=547 ATCCGACCGAGGGATTCCCAGAGATCGGTACGACATCTTCCGCATTCGTCAAGGCATGAGACCCAGAAGTACTGATGAGG CATATATTGACTTAAGTAACAATCCTATGATCGACGGACTTGCGCAGACAGTNCTGGTTTNCAAAAACAGAGAAGCAACA GGAAAACAAAGAGGAGACAATTCTGATGGCTCATATTCTGAGCAAACAAGTGGAGGCAAAAATATGTCAAACTGTAGTTA TCAGCAAGATTTTGGTGAGAACTTAGGTCCACTGGTTACTTATAGAGTCGATGATGCATCCAAGCTAGGTGATAATAATC GTAATTGAAATTTTAAATGAGAGGATTTTATCACTCTTTCTCATCACTGTTGTCAGTTATTTTTCTGGTAATTTTGATCG GTCAATTCGTTCTCTCTACAGTACTCAAAAACAGTACTCAAAACAAATTATAATTTATTACTTCTTTTATAAAACGTGCA AAAATGAATGTTTTTTTTTGCTTTGGTTTGGTTTTTGTAATTATATCTATTAAATAATCTATACAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1290: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099202330209AA559513MC280422.NA3TBRI-Saber-cercaria-A
17370263189946AA999391MCCE3236.M1FSchistosoma mansoni, cercariae
17370923190012AA999457MCCE3321.M1FSchistosoma mansoni, cercariae
17370943190014AA999459MCCE3323.M1FSchistosoma mansoni, cercariae
17371103190030AA999475MCCE3349.M1FSchistosoma mansoni, cercariae


Date: 15:15:19 on Thu 23 Nov 117.