CShisMan2_13


Sequence

>CShisMan2_13 (7 EST) Length=847 GCACGAGTACATGATTTATTTATTTATTCATACGCGTATATACACGTATACAGAAAGCAAAAACAAAACATTGTCGAATC AATGACTTAAGGTGAATCACGATAACGTTCAAATTTGATATTTTTACGCTTGTTCACTTTCTTGAACAAGTATCTTTGTA ATTTATACTCAGCTGTCAATTTAGATGGTTCGAACTCTTCCATCCATGCAACGATAGCTGGACTGATGAGAGTCGCGGGT CGTGCCCTTGTTCGCTCTTTTGTATTCTTTAGTTGATGCTATTGAATTGCCATTAACACCGAAAACTTGTTTAGATGTTT GCGTCACTAAATTTGATGGGGCTGAAGAAGATGCGTGTTCCAGAGGCTGTGTCCTGTCAAACTTGAATTCATTACCAGCG ACATTTACTTGTGAGGAATCTTGTGATGATGTATACAAGCCGGATACAAAGTTAGTTGCTGCTTGCAAAGTAGGCTGTGG TGCGACTCCGAGTCACACATCTATTCGACTTGGGTTTCTGCCTGTTCAAAACTTCTTTAGCAGTTTCTTCGACAGTATTC GTCATTTATTGGGAGGCGTAAATAACGGTTCGGGAGCCAATGCGGATACCAAAACTAATAAGGTAGACGGCGACATGGAT TCAGATTCTGGTAATCATGTGGTCATATCACGCGTTCGCATTTTCCATAAATTTTGCCCCATATTGACGCACATTGAAAG TCCACTGGAATTCACCATTCGAAATAAAACCACTCTTTAATTTTGCGTGGAATCATTCCACAAGATGATGATGCTTATGT CAAAGCTGTAAAAAATAGTGATCAGAATATTATTCGTATACATGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_13: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7808201705415N21759SMNHADA017071T3SmAW
7823851713223AA143818MCCE0114.M1RSchistosoma mansoni, cercariae
8733171858029AA233977SMIPADA000050M13RSchistosoma mansoni adult worm Lambda ZAP II library
11529162245751AA508311MAAD0437.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18148973385257AI067290EST208967Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155303385890AI067923EST209611Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158163386176AI068209EST209900Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:52:4 on Fri 24 Nov 117.