CShisMan2_1304


Sequence

>CShisMan2_1304 (36 EST) Length=467 CTCTCTCTCCTCGTGCACGAGCATCAACCGAGCACGACTTGNAAACTACAGCAAGTAAAAGCCAAATCAATCATGAATGT TCCAATAACTCGTGAAGAAGTAACATGTATATTCAATCAAATTGATAAAAATCACAATGGATTTGTTACAAATAGAGAAT TAAGTTCATATTTCAGAAAACATCATGCAAAATTCAATCGTCAAGAAGTGAAGAGTTTCATTTGTAAATTAGACAGTGAT GGAGATGGACAAATCAGTTTACCAGAATTAACAAGAGCACTTACTGGTAGATATTAACCAGTTGACGTATAATTCTATTG TTTGTTATATTTTACTGTCAACATTTTTATTTTACATGCACATTGAAACCGCTTGTATTGTGATGAAAAACGCACAGTGT CAATGTTTATTCTTATTCTAAAATAAAAATAATACGATTGTTNANAAAAAAAAAAAAAAAAAATTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1304: (36 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824501713288AA143883MCCE0271.M1RSchistosoma mansoni, cercariae
12098282330117AA559421MC250435.NA3TBRI-Saber-cercaria-A
12098292330118AA559422MC250436.NA3TBRI-Saber-cercaria-A
12098352330124AA559428MC250443.NA3TBRI-Saber-cercaria-A
12098362330125AA559429MC250444.NA3TBRI-Saber-cercaria-A
12098552330144AA559448MC260436.NA3TBRI-Saber-cercaria-A
12098642330153AA559457MC260450.NA3TBRI-Saber-cercaria-A
12098702330159AA559463MC260458.NA3TBRI-Saber-cercaria-A
12098772330166AA559470MC260467.NA3TBRI-Saber-cercaria-A
12098852330174AA559478MC260483.NA3TBRI-Saber-cercaria-A
12099162330205AA559509MC280411.NA3TBRI-Saber-cercaria-A
12099182330207AA559511MC280420.NA3TBRI-Saber-cercaria-A
12099342330223AA559527MC070516.NA3TBRI-Saber-cercaria-A
12099452330234AA559538MC070534.NA3TBRI-Saber-cercaria-A
12099472330236AA559540MC070536.NA3TBRI-Saber-cercaria-A
12099902330279AA559583MC080510.NA3TBRI-Saber-cercaria-A
12100042330293AA559597MC080525.NA3TBRI-Saber-cercaria-A
12100072330296AA559600MC080529.NA3TBRI-Saber-cercaria-A
12100122330301AA559605MC080538.NA3TBRI-Saber-cercaria-A
12100272330316AA559620MC090704.NA3TBRI-Saber-cercaria-A
12100282330317AA559621MC090705.NA3TBRI-Saber-cercaria-A
12100392330328AA559632MC090724.NA3TBRI-Saber-cercaria-A
12100492330338AA559642MC090747.NA3TBRI-Saber-cercaria-A
12100742330363AA559667MC180911.NA3TBRI-Saber-cercaria-A
12101442330433AA559737MC140304.NA3TBRI-Saber-cercaria-A
12101672330456AA559760MC140341.NA3TBRI-Saber-cercaria-A
12101922330481AA559785MC210277.NA3TBRI-Saber-cercaria-A
12101952330484AA559788MC250445.NA3TBRI-Saber-cercaria-A
16452393056737AA917194SMTBCEA000340SKSchistosoma Lambda Zap II cercariae
16891723116541AA952835SMTBCEA000419SKSchistosoma Lambda Zap II cercariae
17368553189775AA999220MCCE0265.M1RSchistosoma mansoni, cercariae
17370533189973AA999418MCCE3272.M1FSchistosoma mansoni, cercariae
17371393190059AA999504MCCE3407.M1FSchistosoma mansoni, cercariae
17371843190104AA999549MCCE3474.M1FSchistosoma mansoni, cercariae
17372433190163AA999608MCCE3578.M1FSchistosoma mansoni, cercariae
17372883190208AA999653MCCE0271.M1FSchistosoma mansoni, cercariae


Date: 5:10:33 on Sat 18 Nov 117.