CShisMan2_1311


Sequence

>CShisMan2_1311 (2 EST) Length=406 GGCGAAACGGCGTTTGCAGTTTTTCCTAAGCACATAACTACTCATTGCACTGGTTCTCACTTAAGCAGAGAAAGTTTGGT CATGAGTTTATCCAGGTTATCTCTGTTGCCGATGCTGCAGACGTGGACTTTTTGTTTCTCCCCACCGACTGAGTTCTACA GCACATCAAGGTGGAACGTTTAATTGGCTTGTTGAAAATTATCCGGTTACATATCTTTCAACACTAGTCGGGATGGGCGT GGTTCTCATGATTGGCTACAGCATTGTTTTGTGTGGCAAAGAAATCCTGATCTTTACATCCCAGTATACGATANAGTGCC TCGTGAATGAAACTCTTTTTTAATAAAGACTATTTTGGGAGCCCAAGTACCAGAAACCTCGTGTATAACCCCTGCTGTCC GAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1311: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098202330109AA559413MC250425.NA3TBRI-Saber-cercaria-A
12101832330472AA559776MC210227.NA3TBRI-Saber-cercaria-A


Date: 23:20:3 on Sun 19 Nov 117.