CShisMan2_1318


Sequence

>CShisMan2_1318 (2 EST) Length=306 CTCGTGCCGTTTAGAGGCTATAGCTCACGAACAAGGACTTGCAGGTTTTAATCCAGTCGCTTTCCTCCAANACCCAACTG GCACAAACACTCGCGGTGGATTGGGCTCTGGAAGAGGCAGCAGCCAAAGAGGTGGATATAACAANTTTGGCGGTTCGCGG TCGGGTTCCAACTTACCCAGTGTCACTAATCCTGATGGACTCCGGGAAGATACAATTTTTGTCAGTAATCTGCCTCAAAA TATTGATCATGATGTGATGAAGTCTCAATTTGGTGTCGTTGGGAAAATAAAGATCAATTCCAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1318: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098512330140AA559444MC260431.NA3TBRI-Saber-cercaria-A
12100652330354AA559658MC240737.NA3TBRI-Saber-cercaria-A


Date: 10:10:40 on Fri 24 Nov 117.