CShisMan2_1320


Sequence

>CShisMan2_1320 (5 EST) Length=448 ATATATATATATATATGTATGTAAACAATAGACATCAAATCGTCATTGGTTCCTATACTCTAGCAACTAATGCACCAAAT TCACCAGGTTCCATACAAACACACATACACACTTATATATACATATACACTTATCTATAAACACTTACATTCATCCAGAA CATGGTACTTAGTGTCATTTGAACAATTCAAAAGGAAAGAAAAGAAAGGTAAACCCCGTAATTATAATATGCCATTACTT TAATTGTTTATCTAAACTTTCTTATCAATAAATTATGCACCATATGCGTTAAATATATCAAGTTGCAAAAAAGGAAAAAA ATATATAATATCTATATCTATGATATACATTTACCATACATATACAAGTACGTGTATTCTTCTAGTTTTCCGTGTTGGTT GCGTTCTTCTTTTCTTCTCTACCTCGCGAATTTTCTGAGTATTCTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1320: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344666975531R95422SMNHADA009084SKSmAW
5137741445027W06807SMEST0443Schistosoma mansoni, adult worm, Gloria Franco
5137841445037W06817SMEST0453Schistosoma mansoni, adult worm, Gloria Franco
7641911685507AA125688MLLG0253.M1FSchistosoma mansoni, lung stage
8733261858038AA233968SMIPADA000059M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 2:32:37 on Wed 22 Nov 117.