CShisMan2_1326


Sequence

>CShisMan2_1326 (2 EST) Length=522 TGNAATTCATTCGACAAACAACCGAAAAAAAATGGTTTGTTGTAAAAAACAAAATAAAATTTATGATTATGTTGATAAAA TTCATTCACATCTTAATTCCAAAGAATTAGAATTATTAGAACGTCAATTTATATTANATTGTATTGCTGTTAGACAAATA TGTGATGATTATNCTAAAGCAAATCCAAAACATGGATCTATTATNCCNCCATATAATGGACAATTAGATCCATATGCTAA ATCATATTTTGAATCATTGAATATACAAAAATCATTAGAGAAAACTCGGTCAGACACCACATGGAACATCAATTCGAACG GTGAAATAGCTGATAGATTTATTATAAATTCAGGAGCACCAGCTGATTATATTCCGACCGACGTAATCAAATGGTTGTGG ACCGTTCAAGAGAAATATGGGTGACATGACCTATCATGAATGGAAATAAGTAGTACCAAAGTCATATCATCTACTATACT ATATATATATAACTGAAGCCTTCCAAGTTACTAACTTAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1326: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099602330249AA559553MC070552.NA3TBRI-Saber-cercaria-A
16452153056548AA917154SMTBCEA0000120SKSchistosoma Lambda Zap II


Date: 20:50:31 on Thu 23 Nov 117.