CShisMan2_1332


Sequence

>CShisMan2_1332 (2 EST) Length=348 CAGTTACAAAATTTCTTACNTGGCTACGACNATGAATCAGATCAGTAACATGNTGAAAGACTTGCCAAAGAAGGTNTGNA GATACCATGAAATAGTGATNCNCAACCAGAGTGATATACAGTGGACTATATAACATATATGATCAACAAATCATATAGAA TTAAGAGGAAATAACAGTGAAATAGAATGAGAGCCATAAATAAGTCATGTTGACAAGTGTGTGTGTGTGTGTGAAAGTGA ACATAAATACATAGTACATACAATATGACTTTTACATGATAGGTCAATGNTTTTTTATTAGGTTGTATAATTAGAGAGNG AAAGAGAGAAACCANAAACCAGTTCCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1332: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179911125880N20708SMNHADA002024SKSmAW
9100461906111AA269079MA1MA014.AA3S. mansoni adult Lambda Zap


Date: 0:25:33 on Fri 24 Nov 117.