CShisMan2_1336


Sequence

>CShisMan2_1336 (6 EST) Length=404 AGAAAACGTGTGAAAACATGGNATCGTCAGCTGACAGAACAAGAAATGCGCACTATTTTTGACCACNTGGATAGGAATCA CAATGGATACGTGACTGCTAAAGAACTGAAATATTTTTTAAGACTACACGATGCGAGAGTCACAAATAGAGAAGTCAAAG AATTCATTCGTAAGCTTGACGAAAGTGGAGACGGTCAAATAAGTTTGCATGAATTTATGAAAGCATTTTCGTCACAAAGA AGATCCTTTACTACAGACTTCAGGACAATACGAAGATAAATATTTGGTTGTCGTATAATTTCAAATGTTTAATCAACAAT TTTATAGATTTACTAAAATTATTAAATGAAATGCCTTTAATAAAAACATAATAATAAANTTGTTTCGTCAAAAAAAAAAC CTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1336: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098562330145AA559449MC260437.NA3TBRI-Saber-cercaria-A
12099442330233AA559537MC070531.NA3TBRI-Saber-cercaria-A
12101002330389AA559693MC031025.NA3TBRI-Saber-cercaria-A
16891193116488AA952782SMTBCEA000101SKSchistosoma Lambda Zap II cercariae
16891363116505AA952799SMTBCEA000163SKSchistosoma Lambda Zap II cercariae
17369443189864AA999309MCCE3123.M1FSchistosoma mansoni, cercariae


Date: 9:59:0 on Wed 22 Nov 117.