CShisMan2_134


Sequence

>CShisMan2_134 (20 EST) Length=588 ATTGGACAATTTAATTTGGGATTTATAATAGCACAACATAATCAAGATTTATTCATCATTGATCAACATGCTAGTGATGA AAAATATCGATTTGAACAATTATCAGAAAATTATCGATTTAAAAGTCAACCATTAGTTGTGCCTCAAAAGTTGAATTTAA CAATAACAAATGAACAAGTGTTAATCAATAATTTGGATGTNTTCGCTAGGAACGGATTCGCTTTTCGTATTCACAGTGAC NAACCTGCTGGTCAACAAATATCTCTTGTTGCTGCACCAATGCTAGAAAACAAGTTATTCAGTTACAGAGATATTGAAGA AATGTTGTTTGTATTATCTGAAACATGTAATAAGAAATGTCGACCATCCCGTTTGAGAGATATACTTGCTTCACGATCAT GTCGTAGTGCTGTTATGATTGGAACAGCATTAGATCNTAAAAAGATGAAACGAATCTTAACAAATATGGGCTCCATGGGA TCATCCATGGGAATTGTCCACATGGGACNTCCAACGATGCGACATTTATATCATTTAAACCCTTTAAATGAATAACAATC AATAATCATATTGTACCTATAAGTTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_134: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694003509801AI111113MF004A10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694083509809AI111121MF004A01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694113509812AI111124MF003H10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694313509832AI111144MF003G01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694543509855AI111167MF003E02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694633509864AI110894MF003D05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694673509868AI110898MF003D01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695003509901AI110931MF003A02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695193509920AI110950MF002G06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695203509921AI110951MF002G05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695353509936AI110966MF002F03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695433509944AI110974MF002E06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695533509954AI110984MF002D08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695873509988AI111018MF002A07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696183510019AI111049MF001F07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696243510025AI111055MF001E11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696253510026AI111056MF001E10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696373510038AI111068MF001D07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696703510071AI111101MF001A09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696733510074AI111104MF001A04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 23:27:32 on Sun 19 Nov 117.