CShisMan2_135


Sequence

>CShisMan2_135 (3 EST) Length=588 GCACGAGCCCATTCGTTTGTGGCTTCCTCAAATTTCTCTATGGTATACTTCTCTCGCTCATTCTGATTAGTCAGTTTTCG CAGAGTTGTATCTCTTTTCATCAATTCATTTGTCTTCTTCCTGTAAATCTTGGTAGCAGTAGTAGTAGTAATACCAATGA TAATTATCGTAACAGTGACGATCAAACTAGTGTATTTAAAATTGTTATCTCCGAAGATACATCTCTTTTTCATTCTGTTT CGTTCGATCTTCATTTTCATTCATTAATATGATTAATACTACACATATTTCATATATATTATTTTTTGCTTTTATTCTGT TTCTTGTCTAAATATTTACCGTGTCACCGGTTGATTTTTTCTTTGTAGTTTCGTGTATTTCTAATTGTCTTGAAGACATT CGTGTCTGTTTTATAATCTTAGTTCGATGTTCAATTATTTTATTCGTTTTTTGGTATTAAATGTAACAAATGGTGTAACT TGATCATCTCATAAGTTTGTCATTGACACTTCGTTATCAATTCAATTTATTGGGTTATTTGATGTAGCTTTATGTGTATC TGCATCTATATTTACAAATATCTAAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_135: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147263385086AI067119EST208789Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147993385159AI067192EST208866Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153183385678AI067711EST209394Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:42:35 on Sat 25 Nov 117.