CShisMan2_136


Sequence

>CShisMan2_136 (11 EST) Length=586 NGNAATATCCNGACTCGGACCTTACTTTAGTAACAATAATATGGGGTCATACCCACCGGATTCCATTTGAATACTGTTGC AGGTGGTTGTGTAATAATCACTTTCTGGCAGTCTTTCTTTCGTATTGTGGAGGAGGTGGTAAAGTAACTTTTATGCTTTC CCTGATAAGCAGGTGGAGGAGTCGGAGGTAAACCGGGTACAGGGAATGATGGAATAGGAGGCGCAGATGGAATAACTGCC CTATTTAAGTTTGTTCTTTGGACTATATTTTCATTCCGAATGCATTGAGCATTAAATCTGTTTGCTGATGATTTTTTGGA CAAGAAAGCATCATTATGACCACATTTGCGTGCCAATTTTCCAAAGCGATTGCAATAATAACAGTCAGATCTTGTATTTG TATGTAATGGTCGGGATGACGATTGAGCAAATCGAGGAACAATATTCGGCCCGTATACTGGGTTTTCACCACGATGCTTC ATTGTCAATAGCAGCTATAATTGACATTACATCGGTCCACGGGAACCGAGCTTTTCTTTCACTTAGTGTTTTTGCTACCT AATACTTCCTTATGGCAGATAAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_136: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694133509814AI111126MF003H08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694203509821AI111133MF003G12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694233509824AI111136MF003G09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695623509963AI110993MF002C11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695823509983AI111013MF002A12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695883509989AI111019MF002A06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695943509995AI111025MF001H11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695993510000AI111030MF001H06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696303510031AI111061MF001E03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696423510043AI111073MF001D02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696463510047AI111077MF001C10.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 16:3:41 on Fri 17 Nov 117.