CShisMan2_1362


Sequence

>CShisMan2_1362 (2 EST) Length=509 GGGGTTGTAACTGGCACTGTATTCTGTTTGCTTGTTTTATAATAATTTAAAAGTTTTAATAGTGGTTACAATCACAACAC AACCACATAGGAATTAATAGGATACAGTATCATCGATGTTCAAGTTTAAGATAGATTGTATTAAGCTTCAACGATAAGGT GTTTATGGAAGATAGCTTTTATTTTTAATGATACTGTCTTATCAGCATGAAAATTAACAGAGATTGGCTTCAAAAATAGT TCATCTAACCGGTACACCAGTGAAATATGACTCGTGCCGAATTCGGCACGAGTGGTTATACATTTTAAACTGAATAATGT TTCTTTAAAAAAAAAAACTTTTAAATCATTCAAATCTTTACCTGTTTTCTTGTTTGCCTCACATATAGAATGCTGGATTT TGTACAGAAGCCTAAAATATCAATGTGGATGAATATTATTTCCTAATTTAATCGACTACGTATGGAAATATCTACTATTT CTGATCGCTAAGCAAATATACTATTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1362: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369413189861AA999306MCCE3120.M1FSchistosoma mansoni, cercariae
17533723228047AI014215MEEG0386.M1RSchistosoma mansoni, egg stage


Date: 2:51:59 on Tue 21 Nov 117.