CShisMan2_1380


Sequence

>CShisMan2_1380 (4 EST) Length=343 AAGAAGNACCAATGATGTAATGGAATGATNCCCGAACATGNCCGANANATATATATTGATAGAGTCTATGTGTTTACCAA NGGTGATGATCGTGAGAGATTCACATAGATACATTATTGGAATCAAATGATATCACCTTATTATTGCACATTACGCCTTC AATACTTATAATAATGATAATGATGGTGATATAGATGTGATTGTCTGTACTGATCCCGAATCATCAACTTGTCACCATAG TTTCAACTTCATTGTTGATTATTAGATTAATCCCTTCTTTTCATTCATCATTCACAGTTTATCCATTCTATAGAAGCCAA CCTGGATATTTCACCATTCTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1380: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156531122596H98375SMNHADA015042T3SmAW
4350011154025N33626SMNHADA001048SKSmAW
11587292252906AA514102MA2MA114.AA3S. mansoni adult Lambda Zap
15130102854290AA791335SMTBADA000777SKSchistosoma Lambda Zap II


Date: 22:6:59 on Fri 17 Nov 117.