CShisMan2_1382


Sequence

>CShisMan2_1382 (2 EST) Length=304 CTGGTTATAGAAACAGTGTATCACCCAGAAGTCAACGATACATCAAGGTCTAGATCTCGTTCCAAATCACACTCGCGTCG CTATAGGAAACGAAACGGTAGTCGTGACTTTTATAGTCGCAGCCCTGGATACGGATATAGAAGTGCCGGGCGAAAGAGGT TTCTTCGGGCCACGAGAAAATCTACCCTTGNAGGTGTATTGGTGTCTTCGGTTTATGCTTCACACACAAGAAAGGAACCT TTATGATATTTTTGGGAGTATGAATATTGAAGATGTACAATTAGCTATTCGACGAATACACAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1382: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103091907427AA269306MS1MM013.AS7S. mansoni sporocyst Lambda gt11
9262971929524AA285205MC1AO009.AEOS. mansoni cercarial Lambda gt11


Date: 11:2:18 on Tue 21 Nov 117.