CShisMan2_1384


Sequence

>CShisMan2_1384 (2 EST) Length=300 CGAACCACCAATCACAGTATGAGACGCCCAACATCACATTAACTCTTGTTTACACCCTTGGTATTGAATTATACCTTTTG CCTCTTTATAGTTTCANTTCCNTTGATTTTATTTTTTCCCTATCCCTCCACCTAGTTTAATGTTTCGGGTATGTTATTTA TGTATTCCTTTTTTTTCACTGTTTTAATAAACTGTATTATTAATTGTTTATTTTTGTATATCAACAGTGTTAATTTATGT TTTAGAAGCCCCCAAATGTCCTGGTACGGCCAAGAGTGAGGAGAGTCCCCTATCCCTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1384: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826422160099L81236SCMRAP0355C2/S1 day seven schistosomula mini-library
11826652160122L81259SCMRAP0380C2/S1 day seven schistosomula mini-library


Date: 21:9:4 on Fri 24 Nov 117.