CShisMan2_1389


Sequence

>CShisMan2_1389 (3 EST) Length=325 CGAGAAATGNGNGAGATATAGAGCGACAGAGATGAGAGATAGAGAGGGAGAAAAGGTGAAAAATTTAATACTAAGAATAT TAAATGGATACACAAATTCGAAATCTTATTAGGAATATTATTACCAGGGTTTTTTTATTCTTTGGAAATGAAAACAATCA AAATCAAAAAGACAGAGACTNTNTNTNTATGAGNGAGAGAGAATGTTTATTATAAATATTATTGTTGTAGATCCTGTTTA GTTAGTATCAATGGTTTTTTATGAATCTTTTGAATATTGTTTGTTTTAATTAATCAACAATGAATTGTAAAATGATGCTC GTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1389: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8578391832599AA218506MAAD0179.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
9102351906699AA269232MA1AS001.AASS. mansoni adult Lambda Zap
12165542338803AA566171MA3MARO1.AA3S. mansoni adult Lambda Zap


Date: 14:35:24 on Tue 21 Nov 117.