CShisMan2_1391


Sequence

>CShisMan2_1391 (2 EST) Length=312 CAGTGTGTCCTATATGTTTGCACACTGATTATACACGTAAATCCGTGTTTNCANAATAAGGTAGTNAAATGTTTTTAGCT GGAAGTATAAGTATAGTAATNCAATTTTATAGCGATGGATAAGATATATAAAAAGAATCCAACCAGNCTTTATAAATGAT TAGAAATCAAAGATNCAAGAATTGATCAACAAAAAGTTGGAACAATAACTTTCACGCAGAGAATCTTATTTCTTTCTGTA AAAATCTGATGGAAGTACGTATGCAGAACAATGGTAAATTGTTTGATAATAATGGTCATAAATAAACGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1391: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180671125956N20784SMNHADA008076SKSmAW
9102391906703AA269236MA1AS005.AASS. mansoni adult Lambda Zap


Date: 9:2:19 on Tue 21 Nov 117.