CShisMan2_14


Sequence

>CShisMan2_14 (3 EST) Length=678 GCACGAGGCCACACGTAAAAATCATCAACGAGCTATGGAATCACAACAAGCTAGTTTAGAAGCTGAAGCAAAGGGTAAAG CAGAAGCTATGCGTGTTAAAAAGAAACTTGAACAGGATATTAATGAGTTAGAAGTTAGTTTAGACGGTGCAAATCGTGCT AGAGCTGAACAAGAGAAAAATGTGAAAAAGTTCCAACAACAAGTACGTGAATTACAATCACAATTAGAAGATGATCAACG TCAACGTGATGATTTACGTGAACAATTCCAAGCTGCTGAACGTCGTGCAACTGTATTGGCTGGTGAATTAGATGAATTAC GTATAGCATTAGATCAAGCTGAACGTAGTCGTAAAATAGCTGAAGCTGAACGTGCTGAAGCATCGGATCGTGCGACAGAA ATGTCTACACAAACTGCATCATTAGCTGCACAAAAACGTAAACTTGAAGCTGATTTAGCCGCTATGCAGGCCGATTTAGA AGAAGCTGCCAATGAAGCTAAACAAGCTGATGAACGAGCTAAAAAAGCTATGGCTGATAGCGCACGTGTATTTGAAGAAA TTCGTCAAGAACAAGAACATACACAACATGTTGAAAAAGCTAGAAAACAACTTGAAATACAAGTAAAAGAACTTATGGCT CGTTTAGAAGATAGTGAATCAGGTGCCATGAAAAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_14: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153633385723AI067756EST209439Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154873385847AI067880EST209567Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156443386004AI068037EST209726Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:17:58 on Wed 22 Nov 117.