CShisMan2_1402


Sequence

>CShisMan2_1402 (5 EST) Length=290 TCATACTCTATTCCACAGCGTCCTAATTTGAAAATAATTCGAGACGAGGATACATATAACAGCTAACGTTACGTAAGTAA ACTAGATCATTTCTTCAAAAATAATGCACCTTGCAAATCACCAGAAATGATGGTGATTTATAATTAATAATACAGTAGAA CTATAGAATATGAACAATCTTTATCTCAGTATAAACAAATTATTTTTTTTAATAATATTTAGTAATTTTTAGTTATATGT AAAATAAGATTTTGTTTGTATTCTGTATTAAATATAAAATATTCATTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1402: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100612330350AA559654MC240721.NA3TBRI-Saber-cercaria-A
12101052330394AA559698MC031037.NA3TBRI-Saber-cercaria-A
16452413056739AA917196SMTBCEA000344SKSchistosoma Lambda Zap II cercariae
16452423056740AA917197SMTBCEA000345SKSchistosoma Lambda Zap II cercariae
16452433056741AA917168SMTBCEA000346SKSchistosoma Lambda Zap II cercariae


Date: 22:33:38 on Tue 21 Nov 117.