CShisMan2_1403


Sequence

>CShisMan2_1403 (2 EST) Length=281 GTTAAACGTTATATTTTATCCTAAAGTAAATTGCTTTTNGNTTTNTNATGGTAGCCTACTCTNATATAAATGATCGAGAA CAATCGGAATTTTTAAAAATCCCTATCTCAAATTGTTAAGGTGATATCTTACTGTGTCCTCAATATAAAATAGGTTGCAG TCTAGATACATCTTCTTCGCTCCAAGTCTCATTAAATTCGTGATTATTTAAATATATTAAGTGCTTCCCACACAACTATT GTCCATTATNTTCACCNAATTGTAAGTCTCAAAAATGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1403: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156551122598H98377SMNHADA015044T3SmAW
9102091906274AA269206MA1MR029.AA3S. mansoni adult Lambda Zap


Date: 12:47:41 on Sat 18 Nov 117.