CShisMan2_1409


Sequence

>CShisMan2_1409 (4 EST) Length=311 TGATTTATTTAAACATCACAAATACTATGCAACATCTAGTCTAATTCCCTAGTGAATTAAAAGACCAATTTCATTTAGAA AAGCATTGAATAGCTTTATTTATTGTTTAATTTTTTTTATTACATTGTGTTGACAAGCTGTCGAAACTGTACTCCTACTC GTTGATTTCTTGATCCACATCCATATGAGTGTGTTTGGTTATTTGGATCCCGAACATTTGCCATCACATTTACAGGTGCC AGAGGTGCAGTTACAGCTCGATCCGCAACCACATTTTCCTTCACAGCAGTCAGACATTGTATTAGCTCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1409: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39192514586T14419SMEST0080Schistosoma mansoni, adult worm, Gloria Franco
5858731377932U58054SMU58054Schistosoma mansoni adult worm Lambda ZAP II library
7364471644583AA098613SMTBADAMS0607SKS. mansoni cDNA
16886413115411AA952315SMTBADA000607SKSchistosoma Lambda Zap II


Date: 9:56:4 on Wed 22 Nov 117.