CShisMan2_141


Sequence

>CShisMan2_141 (6 EST) Length=711 GAAGTTATTGAAATTTATTTGTGCGAACGTATGAAAAGTATTTTGGATGAATATGAAGTCTATCCAATCTACCATGACGG AATAAAAAGATAAGAACCGGGAAGTTTAAATGTTTTAAAGTGAAACAAGCATGCCTTTTATTAGAGTTTGAGCTTTCGGC TTGCCACACAGCAATTCAACTAATTTCATTGCAAAAGCAAATGCAGTTCCTGGACCTCGACTTGTAACGAGTTTATCATC AACAACAACATTGTCTTCACAATATTTATAACTCGGAAGTTGATCCTGGAAGCCTGGATAAGATGTCAGCCTTTTTCCTA TAGCGATTTTGTGGGATTCTAGGGCGATCGGTGCAGCACAGATTGCTGCAATGTACTTGCCGTGTTTTTCGTGCTCTTTA AGTATTTTACCAACTAATTCCGATGACGCCATAGCATTAGAACCACCCATACCACCTGGCATTACTACCAGATCAAAAAG TTTTGACGAAACGCTAGAAAGTGAAACATTTGGCTTTATACAAACACCATTGCTTCCCTTAAGCACTCCATCGCCCTGAA GTCCACCAACAGTAACGTTTACCCCTGCTCTAGCCAGTACATCAGCAACCGTCACAGCCTCAATCTCTTCAGCTCCCTCA GACAGAATCAACAAGGCTGATGCACTCATTTCTGCTCTTGATGCATCGAGGCCTCGTGCCAAGCTTGGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_141: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350601154084N33685SMNHADA018024SKSmAW
5137691445022W06802SMEST0438Schistosoma mansoni, adult worm, Gloria Franco
5137701445023W06803SMEST0439Schistosoma mansoni, adult worm, Gloria Franco
7641661685482AA125730MLLG0175.M1FSchistosoma mansoni, lung stage
15130142854294AA791339SMTBADA000812SKSchistosoma Lambda Zap II
18155023385862AI067895EST209582Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 1:42:11 on Sun 19 Nov 117.