CShisMan2_1415


Sequence

>CShisMan2_1415 (2 EST) Length=295 GTTTAGTTGGTCTCGGCGACGAGGTCGGGAGGTAGCAGTGTGCCTGATTCGGCGTTCACTGGTTGGAAATACTATTTTAA TTCTNACACCTTGAAAGGCCGTTTTAATATANTAATGGCCAATTATGCAATCTTGTTCGCGGGCATCGCAATTTGGCGAA TGAGGTCAAAGNAAGAAAAAANCCCTAAAAAAAGATGAGACCNGATGATATTTTGGAGTAAAATAGAAGGCTTCTATAAA TTANCATTCGTGTAACCAGTTGCGTCTTGTTCCTNCTGAAATAGAGATTTTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1415: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098392330128AA559432MC260409.NA3TBRI-Saber-cercaria-A
12100932330382AA559686MC180945.NA3TBRI-Saber-cercaria-A


Date: 11:54:47 on Mon 20 Nov 117.